Evidense of Evolution?

[msactech1]

To show my understanding, I offer the evolutionist this thread to prove, or discuss what they believe. Although I will not agree, I would like to see your responses. I may or may not respond, but I will read it because I started this thread.
This is my act of respect towards the religious users of cannabis that do not agree with creationist.

[Brother Adam]

Galapagos Islands.........nuff said.
_________________
-Brother Adam (we are all one family)

“Knowledge will forever govern ignorance; and a people who mean to be their own governors must arm themselves with the power which knowledge gives.”

-James Madison

Police officers acquitted for beating a 64 yr old man recently in New Orleans. In the words of their defense attorney "all he had to do was comply"....and they wouldn't have fractured his face.

[Brother Adam]

Galapagos Islands.........nuff said.
_________________
-Brother Adam (we are all one family)

“Knowledge will forever govern ignorance; and a people who mean to be their own governors must arm themselves with the power which knowledge gives.”

-James Madison

Police officers acquitted for beating a 64 yr old man recently in New Orleans. In the words of their defense attorney "all he had to do was comply"....and they wouldn't have fractured his face.

[msactech1]

What about them? Please explain. I am not here to debate it, but I fail to understand?

[Ferre]

For me it's a simple question. Who's opinion do I trust more, the opinion from scientists who research this issue or the opinion from priests who limit their own range of perspective because of their adopted doctrines?
_________________
█ Please read the Board Rules and Posting, and you
█ Radio Free Amsterdam
People who know truth, speak truth.
Those who don't, quote scriptures.

[Ferre]

For me it's a simple question. Who's opinion do I trust more, the opinion from scientists who research this issue or the opinion from priests who limit their own range of perspective because of their adopted doctrines?
_________________
█ Please read the Board Rules and Posting, and you
█ Radio Free Amsterdam
People who know truth, speak truth.
Those who don't, quote scriptures.

[msactech1]

What about scientists that don't agree? How would you deside which scientists or group of scientist to follow? Would you just have to follow your instincts (most logical, too you), or another way?

[Ferre]

Science is an ungoing process as I look at it, and I follow the progress knowing that most answers have caused even more questions, I find it interesting to see how on some fields scientists do not agree while in other fields of science there is much agreement all over the world. As far as I'm concearned as long as questions are not answered I don't mind at all that I don't know or anyone else for that matter. maybe science will find answers for the questions I have, and maybe not, it doesn't bother me at all, life is beautiful anyway and I love it.
_________________
█ Please read the Board Rules and Posting, and you
█ Radio Free Amsterdam
People who know truth, speak truth.
Those who don't, quote scriptures.

[Ferre]

Science is an ungoing process as I look at it, and I follow the progress knowing that most answers have caused even more questions, I find it interesting to see how on some fields scientists do not agree while in other fields of science there is much agreement all over the world. As far as I'm concearned as long as questions are not answered I don't mind at all that I don't know or anyone else for that matter. maybe science will find answers for the questions I have, and maybe not, it doesn't bother me at all, life is beautiful anyway and I love it.
_________________
█ Please read the Board Rules and Posting, and you
█ Radio Free Amsterdam
People who know truth, speak truth.
Those who don't, quote scriptures.

[Don Quixote]

in my yoof (youth) , i trained to be a scientist.

i was determined to see the world through the eyes of science and refused to believe in anything spiritual.dont ask me what any of this proves.i dunno ?

my short life as a trainee scientist went like this :-

first i wanted to be a mathamatician -

i was taught this by a brilliant mathematician who was my tutor :-

"it is a fact that every living thing , every physical manifestation , every reaction , every action and all things including chaos , probability and pure chance can be explained in terms of pure mathematics"

hmmmm yes , i can see some merit in that.it is possible.but that neither proves or disproves the point.i was too stupid to be a mathematician.

next biology :-

mr.Jardine taught me this :-

inside every cell there is a nucleus containing a single , self replicating strand of Deoxy Ribonucleic Acid (DNA)

this strand of dna is arranged like a spiral within a spiral within a spiral within a sp ... etc ...etc.

it is composed of 4 Amino acids , they are Adenene , Cytozene , Thiamine and Guarnine.

every DNA strand looks a bit like this ACAGTAGACATGGCTACTACGAGGCTCTTACCGTACAGCT ... etc ... etc ... etc.

ok. its very elegant but the jury is still out .i was too stupid to be a biologist.

ok.next i tried physics. (thanks mr.Joyce.)

wow.it blew my mind.i loved it .you could invent crazy crackpot theories and nobody could prove you wrong , especialy in the field of theorical physics.

seriously though , physics really did try to answere all questions.you only have to look at the work of Albert Einstein towards the last years of his life to see how powerful this branch of science can be.

he theorised that the boundry between matter and energy does not exist ! that infact they are the same thing existing in different states (a bit like steam and ice are different - but they are both water)

that is just one brief example of the power of physics and science in general.

it is the only thing that comes close to answereing that most fundamental of questions - What is the difference between a living man and the corpse of a man - that 'thing' we call life.that mysterious force of whatever.

after a few years of this my head began to hurt a lot .so i started hanging around with my Jamaican friends and smoking lots jamaican lambsbread sinsemilla.

all of which brought me round in a circle back to what brother Ferre said quote "it doesn't bother me at all, life is beautiful anyway and I love it."

my mind is open and i am fascinated by science , but i reject nothing.all things are possible when you dont have definate answeres.

well done Brother msactech1 , you have proved you have an open mind and that you accept that we all have different ideas and answeres.

respect to you for that bro.

wouldnt life be really boring if we knew everything ? i love a mystery or a conundrum.

PEACE.

.

[IntrepidEZJ]

There is a wide range of information out there on this, and if you want to engage, I would be happy to do so.

But, why take minutes or hours out of my time, to present material, that you claim ALREADY, is not going to "change your mind"?

Closed belief system?

Is your house of truth all ready built?

Do you understand what "Fundamentalism" stems from?

I AM NOT INSULTING YOU.

Let me phrase it this way.....

If you accept, that Constantine and the Ecumenical council THREW OUT all of the other gospels, and only kept 4, and then, on top of that, you understand WHY they did it, POLITICALLY, we can start from there.

If you believe the 4 gospels are perfect, and without error, then with much respect, I think I would be spinning my wheels.

No need for a circular argument.

But I will add one small thing......

Look at a picture of a monkey.

two eyes, two noseholes, mouth, ears, hair, feet, hands, so on.

And since you ARE interested in what Scientists say, they say that we are 97 percent similar.

Now yes, that could be "coincedence", but, I think not.

And no, that is not the basis of my argument, just something to ponder on.

A quote from Charles Darwin, the father of evolutionary theory:

For my own part I would as soon be descended from that heroic little monkey, who braved his dreaded enemy in order to save the life of his keeper; or from that old baboon, who, descending from the mountains, carried away in triumph his young comrade from a crowd of astonished dogs -- as from a savage who delights to torture his enemies, offers up bloody sacrifices, practices infanticide without remorse, treats his wives like slaves, knows no decency, and is haunted by the grossest superstitions.

-Charles Darwin (The Descent of Man, 1871)

One more quote....

Man is a Religious Animal. He is the only Religious Animal. He is the only animal that has the True Religion - several of them. He is the only animal that loves his neighbor as himself and cuts his throat if his theology isn't straight.

-Mark Twain

That last quote, will help you understand where I stand and why.

[Mystic Power]

I just enjoy being inside the Great Mystery.


Edited Afterthought: It's all just about belief systems, really. Science can, at times, become as rigid, close minded and dogmatic as religions.

Creation myths are interesting stories.

Darwin-flavored evolution is one such story.

Darwinism vs. Creationism represents rather limited thinking. It's like walking into a huge limitless buffet, yet convincing oneself that there's only two items on the menu.

Corn muffins or....Tuna casserole.

Then...we divide into our separate camps and argue over which is the One True Entre.

"Evidence" is offered by the Corn Muffinists.

"Rebuttal Evidence" is then offered by the Tuna Casserolists.

"The Tuna Casserolists are stupid!" declare the Corn Muffinists. "Ours is the One True Entre."

Then, the Corn Muffinists find division within, declaring that Corn Muffinists who add walnuts are not True Corn Muffinists. "Bastards!" "Splitters!"

----


Creationists insist that God, a singular male, created man in His own image, after His own likeness. Well, if that’s true, He must have been having a hell of a bad day, because we humans are a poorly designed species.

Same goes for the Darwinist Evolutionists. If we evolved, according to adaptation and survival of the fittest, Humans must be an aberration.

We seem to have devolved. We don't have enough hair to protect us from the cold, nor a thick enough skin to protect us from the sun. We have to fashion "clothing" and "houses" to protect us from the elements. As far as houses go, we seem to live in boxes, for some odd reason. Is this progress?

Human beings do not have the strength and bone density of our primate ancestors. Is this evolutionary progress?

We cool ourselves by sweating profusely. Other primates pant, and sweat mildly. This doesn't prove nor disprove anything...it's just interesting to note.

But the number one difference between humans and other primates is that humans have only 46 chromosomes while all other higher primates have 48! We evolved fewer chromosomes.

Interesting. How do we go about losing 2 whole chromosomes, yet end up being "better." Beats me. It makes no sense...yet "better" we are. And not just a little bit better. Tons and tons better. Go figure.

Then, there's the matter of the fossil record...or the profound lack thereof.

According to our mitochondrial DNA, humans have existed as a distinct species for only about 200,000 years, We just seem to have "popped up" out of nowhere.

Darwinist dogma that humans descended from primates (chimps and gorillas) by gradually transitioning through a four-million-year-long series of prehumans known as Australopithecines (Lucy, etc.) and early Homos (Homo Habilis, Homo Erectus, etc.). Even though Australopithecines undoubtedly walked upright (their kind would have left the famous pair of bipedal tracks at Laetoli, Tanzania, 3.5 million years ago), their skulls are so ape-like as to be ineligible as a possible human ancestor. But let’s assume that somehow they bridged the evolutionary gap between themselves and early Homos, which indeed are in the ballpark of physical comparison with humans.

In any series of photos showing the skulls of the Homo prehumans, little changes over time except the size of their brains, which increase by leaps of roughly 200 cubic centimeters between species. Every bone in those skulls is much denser and heavier than in humans; they all had missing foreheads; huge brow ridges; large, round eye sockets holding nocturnal (night) vision eyes; wide cheekbones; broad nasal passages beneath noses that had to splay flat across their faces (no uplift of bone to support an off-the-face nose); mouths that extend outward in the prognathous fashion; and no chins.

Each of those features is classic higher primate, and they predominate in the fossil record until only 120,000 years ago, when genuinely human-looking creatures­ the Cro-Magnons­appear literally “overnight” (in geological terms), with absolutely everything about them starkly different from their predecessors.

We should follow directly after the Neanderthals, which followed Homo Erectus. But now the Neanderthals, which existed for about 300,000 years and overlapped Cro-Magnons by about 100,000 of those, have provided mitochondrial samples which indicate they are not related closely enough to humans to be direct ancestors.

This compounds yet another serious transition problem because human brains are on average 100 cubic centimeters smaller than Neanderthal brains! How might that have happened if we are on a direct ancestral line with them?

Based on fossil evidence...or the lack thereof...it looks as if we just sort of popped up, out of no where.

There seems to be tons of evidence for prolonged evolution within species...but woefully little in terms of one species becoming another.

We, logically, evolved initially from plant-life. Plant-animal hybrid fossil evidence? None. Like religious creationists, it comes down to FAITH.

Primate to human fossil evidence? None. Faith.

Creationist evidence? Big Invisible Guy in the Sky? None. Faith.

...and everyone seems reluctant to simply say, "Hell, I don't know!"

But, I'm quite OK with the notion that there may be...and probably is... something going on that the Creationist myth and the Darwinist myth have not noticed... probably something completely heretical to both camps.

I have NO IDEA what that is.

...but I'm OK with that.

Mango, anyone? A mango is something I can put my "faith" in. They taste great.

Follow Your Bliss,
Ben



Follow Your Bliss,
Ben
_________________
"We are the Ones we have been waiting for."
~Hopi Elder ~

"In Lak'ech"
~ Ancient Mayan: "I am another YOU." ~

[Mystic Power]

I just enjoy being inside the Great Mystery.


Edited Afterthought: It's all just about belief systems, really. Science can, at times, become as rigid, close minded and dogmatic as religions.

Creation myths are interesting stories.

Darwin-flavored evolution is one such story.

Darwinism vs. Creationism represents rather limited thinking. It's like walking into a huge limitless buffet, yet convincing oneself that there's only two items on the menu.

Corn muffins or....Tuna casserole.

Then...we divide into our separate camps and argue over which is the One True Entre.

"Evidence" is offered by the Corn Muffinists.

"Rebuttal Evidence" is then offered by the Tuna Casserolists.

"The Tuna Casserolists are stupid!" declare the Corn Muffinists. "Ours is the One True Entre."

Then, the Corn Muffinists find division within, declaring that Corn Muffinists who add walnuts are not True Corn Muffinists. "Bastards!" "Splitters!"

----


Creationists insist that God, a singular male, created man in His own image, after His own likeness. Well, if that’s true, He must have been having a hell of a bad day, because we humans are a poorly designed species.

Same goes for the Darwinist Evolutionists. If we evolved, according to adaptation and survival of the fittest, Humans must be an aberration.

We seem to have devolved. We don't have enough hair to protect us from the cold, nor a thick enough skin to protect us from the sun. We have to fashion "clothing" and "houses" to protect us from the elements. As far as houses go, we seem to live in boxes, for some odd reason. Is this progress?

Human beings do not have the strength and bone density of our primate ancestors. Is this evolutionary progress?

We cool ourselves by sweating profusely. Other primates pant, and sweat mildly. This doesn't prove nor disprove anything...it's just interesting to note.

But the number one difference between humans and other primates is that humans have only 46 chromosomes while all other higher primates have 48! We evolved fewer chromosomes.

Interesting. How do we go about losing 2 whole chromosomes, yet end up being "better." Beats me. It makes no sense...yet "better" we are. And not just a little bit better. Tons and tons better. Go figure.

Then, there's the matter of the fossil record...or the profound lack thereof.

According to our mitochondrial DNA, humans have existed as a distinct species for only about 200,000 years, We just seem to have "popped up" out of nowhere.

Darwinist dogma that humans descended from primates (chimps and gorillas) by gradually transitioning through a four-million-year-long series of prehumans known as Australopithecines (Lucy, etc.) and early Homos (Homo Habilis, Homo Erectus, etc.). Even though Australopithecines undoubtedly walked upright (their kind would have left the famous pair of bipedal tracks at Laetoli, Tanzania, 3.5 million years ago), their skulls are so ape-like as to be ineligible as a possible human ancestor. But let’s assume that somehow they bridged the evolutionary gap between themselves and early Homos, which indeed are in the ballpark of physical comparison with humans.

In any series of photos showing the skulls of the Homo prehumans, little changes over time except the size of their brains, which increase by leaps of roughly 200 cubic centimeters between species. Every bone in those skulls is much denser and heavier than in humans; they all had missing foreheads; huge brow ridges; large, round eye sockets holding nocturnal (night) vision eyes; wide cheekbones; broad nasal passages beneath noses that had to splay flat across their faces (no uplift of bone to support an off-the-face nose); mouths that extend outward in the prognathous fashion; and no chins.

Each of those features is classic higher primate, and they predominate in the fossil record until only 120,000 years ago, when genuinely human-looking creatures­ the Cro-Magnons­appear literally “overnight” (in geological terms), with absolutely everything about them starkly different from their predecessors.

We should follow directly after the Neanderthals, which followed Homo Erectus. But now the Neanderthals, which existed for about 300,000 years and overlapped Cro-Magnons by about 100,000 of those, have provided mitochondrial samples which indicate they are not related closely enough to humans to be direct ancestors.

This compounds yet another serious transition problem because human brains are on average 100 cubic centimeters smaller than Neanderthal brains! How might that have happened if we are on a direct ancestral line with them?

Based on fossil evidence...or the lack thereof...it looks as if we just sort of popped up, out of no where.

There seems to be tons of evidence for prolonged evolution within species...but woefully little in terms of one species becoming another.

We, logically, evolved initially from plant-life. Plant-animal hybrid fossil evidence? None. Like religious creationists, it comes down to FAITH.

Primate to human fossil evidence? None. Faith.

Creationist evidence? Big Invisible Guy in the Sky? None. Faith.

...and everyone seems reluctant to simply say, "Hell, I don't know!"

But, I'm quite OK with the notion that there may be...and probably is... something going on that the Creationist myth and the Darwinist myth have not noticed... probably something completely heretical to both camps.

I have NO IDEA what that is.

...but I'm OK with that.

Mango, anyone? A mango is something I can put my "faith" in. They taste great.

Follow Your Bliss,
Ben



Follow Your Bliss,
Ben
_________________
"We are the Ones we have been waiting for."
~Hopi Elder ~

"In Lak'ech"
~ Ancient Mayan: "I am another YOU." ~

[aeroplane]

[aeroplane]

[msactech1]

My whole point is to have an open mind. If my mind was closed, I wouldn't care what was said here. I have a G. E. D., a tiny vocabulary, and more interest in other things, so I'm not one to debate. I watched the creation vs. evolution debates, years ago. It was very interesting. You'd have to honestly admit the creationist have a strong case, too.
I do not care about constantene. If I could do it without pissing anyone off, again, I'd say, "Fuck the pope!" because he is nothing but a polititian to me.
I do not follow the teachings of any man. I followed the most logical in my mind. I never had a problem excepting God, but I cannot except another man's version of God, because I have been lied to, too many times.
I chose the way of the ancient prophets, who were murdered by the churches. I chose to find Him for myself in the wilderness. I believe the Bible is the inspired word of God, and I take a literal interpertation. I have to look at multiple interpetations, because people translated it. I don't claim to understand everything, or to be a great person, so I will share my faith, but I can't prove it to you no more than you can prove your belief, to me.
We have a lot in common that we chose not to follow a man, but to follow our own hearts.
The reason why scientist disagree is because when they look at science, they see it through thier eyes. Everybody sees things different. Creation science is structured and has theories and evidence. That's how they see the earth. Creation science is not well accepted, so we didn't learn it at school.
I could continue, but this thread is for you. A gift from me. I may want to pour my feeling out, one day. I think it would help if I listen to you, first. Maybe we can have a mutual respect.

[aeroplane]

Am I the only one confused by the contrast in these two statements? First you said,

[aeroplane]

Am I the only one confused by the contrast in these two statements? First you said,

[msactech1]

I feel that it doesn't matter what I believe, I'm going to be criticized as long as I do not except what everybody else believes. To me, an open mind doesn't mean to believe everything you hear. That's foolishness.
I am open by listining to you and trying to understand or relate. That does not mean I will accept it.
If by not believing what you say is considered being closed- minded, than I am not the only one here that is closed-minded. If being open minded means respecting the opinions and beliefs of others, I can try.

[Don Quixote]

just to start an arguament :-

the genetic similarity between a man and a giraffe = 93%

the genetic similarity between a man and a lettice = 89%

due to the fact that the genome consists of 4 base Amino acids it is NOT possible for any living thing on earth to be more than 25% different .

ok over to you all ...

(ian ducks for cover and puts on his tinfoil hat.)

PEACE.

.

[msactech1]

I'm done arguing. I know I can't change your mind.
I did answer in the other thread. This is still your thread, so hit me.